Vol. XXXIII Issue 2
Article 2

DOI: 10.35407/bag.2022.33.02.02

ARTÍCULOS ORIGINALES

Impact of genetic ancestry on the distribution of interferon-λ4 rs12979860 polymorphism in a global population of Buenos Aires, Argentina

Impacto de la ancestría genética en la distribución del polimorfismo de interferón-λ4 rs12979860 en una población global de Buenos Aires, Argentina

 

Mansilla F.C.1 *

Avena S.A.2,3,4

Dejean C.B.2,3

Turco C.S.1

Capozzo A.V.1,4

   

1 Instituto de Virología e Innovaciones Tecnológicas (IVIT), Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) - Instituto Nacional de Tecnología Agropecuaria (INTA), Hurlingham, Buenos Aires, Argentina.

2 Centro de Ciencias Naturales, Ambientales y Antropológicas (CCNAA), Universidad Maimónides, Buenos Aires, Argentina.

3 Sección Antropología Biológica, Instituto de Ciencias Antropológicas (ICA), Facultad de Filosofía y Letras, Universidad de Buenos Aires, Buenos Aires, Argentina

4 Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Argentina.

 

* Corresponding author: Mansilla F.C.  mansilla.florencia@inta.gob.ar  ORCID 0000-0002-8325-0579  

 

ABSTRACT  

Human interferon-λ4 is a cytokine involved in early stages of antiviral responses. Strikingly, some   allelic variants with diminished antiviral activity reduce the susceptibility to viral infections, thus   they would have suffered a positive selection pressure throughout the evolutionary history of the   genus Homo. An intronic variant within the IFNλ4 locus (rs12979860, T˃C) emerged as one of the   main gene determinants of the response to HCV and other viruses. The rs12979860-C allele has   a differential frequency in African, European and Native American populations, though South   American data are scarce. Here we characterize for the first time the distribution of rs12979860   genotypes in a sample of the global population of Buenos Aires, Argentina, assessing its   association with European, Native American and African parental components. The rs12979860   genotypes were determined by PCR-RFLP in DNA samples from donors of a blood banks of Buenos   Aires (n=96), whose genetic individual ancestry (European, African or Native American) had been   previously determined using molecular markers. The distribution of rs12979860-CC, CT and   TT was 29.17%, 50.0% and 20.83%, respectively. A significant increase in the frequency of CC   among donors with a strong European contribution and a greater impact of the Native American   component among donors carrying the T allele were observed. Native American and European   components were associated to the rs12979860 distribution in a sample of the global population of   Buenos Aires, while no differences were directly attributable to the African ancestry. Considering   interferon´s key role in antiviral responses, our results may contribute to both bioanthropological   and immunogenetic studies associated with infectious diseases.  

Key words: Ancestry, Buenos Aires, IFNλ4 polymorphism, rs12979860 distribution.  

 

RESUMEN  

El interferón-λ4 humano es una citoquina involucrada en la respuesta antiviral. Algunas variantes   alélicas con menor actividad antiviral, paradójicamente, reducen la susceptibilidad a infecciones   virales, por lo que habrían sufrido una presión de selección positiva en la historia evolutiva del   gיnero Homo. Una variante dentro del locus de IFNλ4 (rs12979860, T˃C), con distribución   diferencial en poblaciones africanas, europeas y nativas americanas, surgió como uno de los   principales determinantes genéticos de la respuesta al HCV y otros virus. Aquí caracterizamos   por primera vez la distribución de los genotipos de rs12979860 en una muestra de la población   cosmopolita de Buenos Aires, Argentina, evaluando el impacto de su ancesrtría. Se determinaron   diferentes genotipos de rs12979860 por PCR-RFLP en muestras de ADN de donantes de bancos   de sangre de Buenos Aires (n=96), cuya ancestría individual había sido previamente determinada   mediante diferentes marcadores moleculares. La distribución global de rs12979860-CC, CT   y TT fue 29,17%; 50,0% y 20,83%, respectivamente. Se observó un aumento significativo de la   frecuencia del genotipo CC entre individuos con fuerte aporte europeo y un mayor impacto del   componente nativo-americano entre portadores del alelo T. Los componentes nativo-americano   y europeo se asociaron a la distribución rs12979860 en una muestra poblacional global de Buenos   Aires, mientras que no se vieron diferencias directamente asociadas a la ancestría africana.   Considerando el papel clave del interferón en la respuesta antiviral, nuestros resultados pueden   contribuir a estudios con un enfoque bioantropológico así como a estudios inmunogenéticos   asociados a enfermedades infecciosas.  

Palabras clave: Ancestría, Buenos Aires, Polimorfismo en IFNλ4, Distribución de rs12979860.  

 

Received: 03/04/2022  

Revised version received: 06/30/2022  

Accepted: 08/08/2022

 

General Editor: Elsa Camadro  

 

 

INTRODUCTION

 

 

Lambda interferons (IFNλ) are cytokines rapidly   produced by most vertebrates during the innate immune   response, constituting the first line of defense against   viral infections (Lazear et al., 2015). IFNλ1, 2 and 3 were   identified in 2003 (Kotenko et al., 2003; Sheppard et al.,   2003) and in 2013 a functional form of IFNλ4 was firstly   characterized (Prokunina-Olsson et al., 2013). The   IFNλ4 locus (19q13.2) is highly polymorphic (Fang et al.,   2020) and it was reported that some allelic variants can   modulate the susceptibility, progression and response to   treatments against different viral infections (Chatterjee,   2010; Bravo et al., 2014; Angulo et al., 2015; Ispirologlu   et al., 2017; da Silva Cezar et al., 2020). Interestingly,   the most favorable alleles in this regard correspond to   mutations that are in strong linkage disequilibrium and   restrict the expression, stability or antiviral activity of   IFNλ4 (Booth and George, 2013; O’Brien et al., 2014;   Prokunina-Olsson, 2019).  

Throughout the evolutionary history of the genus Homo   these mutations have suffered a positive selection   pressure resulting in a differential global distribution   which is correlated to the ancestry of different human   populations and may affect the immune response to   different pathogens (Key et al., 2014; Bamford et al.,   2018). An intronic variant that reduces the antiviral   activity of IFNλ4 (rs12979860, T˃C) was characterized   as the main gene determinant of the response against   Hepatitis C Virus (HCV). The rs12979860-T allele is   associated with lower sustained virologic response   (SVR) rates and a lower percentage of treatment   success (Ge et al., 2009). On the other hand, the CC   genotype was strongly associated with spontaneous   resolution and lower susceptibility to HCV infection   (Thomas et al., 2009; Pedergnana et al., 2012; Indolfi   et al., 2014a; Fan et al., 2016). Moreover, genotyping of   rs12979860 is recommended to predict the patient´s   response to different antiviral treatments (Sharafi et al.,   2012; Ramamurthy et al., 2018). Different correlations   between rs12979860 and clinical phenotypes associated   with other viral infections have also been reported,   conditioning the susceptibility, evolution and/or   response to treatment against Hepatitis B and D   (Ispirologlu et al., 2017), Dengue (da Silva Cezar et al.,   2020), HIV (Chatterjee, 2010; Zaidane et al., 2018),   CMV (Bravo et al., 2014; Chmelova et al., 2019) and   coronaviruses (Hamming et al., 2013).  

The rs12979860-C allele has a global frequency   of 0.23-0.55 in African populations; 0.53-0.80 for   Europeans and 0.72-1.00 for Asians, with higher   frequencies in eastern Asia. Data about the distribution   of these variants in South American populations are   scarce and tend to be biased due to the small sample size   and the genetic admixture of the populations assessed.   The Argentinean population´s ancestry is the result of   a deep miscegenation, product of different migratory   waves during the last centuries, which means that the   European, Native American and African components   (frequently underestimated) are present at different   degrees in the gene pool of different cosmopolitan   populations of the country (Avena et al., 2012). In   this regard, the immunogenetic profiling of IFNλ4-   rs12979860, and the association with its ancestry, may be   a potential tool in both anthropological and biomedical   studies associated with infectious diseases. The   objective of this study was to determine the distribution   of the allelic variants of rs12979860 in a cosmopolitan   population of Buenos Aires, Argentina, whose ancestry   had been previously determined by assessing a set of 106   biallelic SNPs (Ancestry Informative Markers) widely   spaced and balanced throughout the genome, that can   discriminate Native American, African and European   ancestry (Avena et al., 2012).  

 

 

MATERIALS AND METHODS

 

 

Study Design

 

 

This study comprised DNA samples from unrelated   donors from both public and private hospitals blood   banks in Buenos Aires, Argentina (n=96). Informed   consent was obtained from all individual participants   included in the study. Most of them (89/96) also agreed   to provide information about the region/country of   birth of all their grandparents, which was included in   the data analysis. The study was approved by the Ethics   Committee of the Hospital Italiano of Buenos Aires and   was performed in accordance with the ethical standards   adopted in the Declaration of Helsinki.  

 

 

rs12979860 genotyping

 

 

Different genotypes of rs12979860 were determined   by PCR-RFLP, as it was previously described (Sharafi   et al., 2012). A 241 bp fragment was amplified by   endpoint PCR (Taq Pegasus®, Productos Bio-Lógicos,   Bs. As., Argentina) following a standard cycle (5 min   at 94° C; 35 cycles of 20 s at 94° C, 20 s at 59° C and   20 s at 72° C; and 5 min at 72° C) and then digested   with Bsh12361 restriction enzyme (Thermo Fisher,   DE, USA; 1U/reaction) for 1 h at 37° C. The primers   used were 5´GCGGAAGGAGCAGTTGCGCT3´ (Fw) and   5´TCTCCTCCCCAAGTCAGGCAACC3´ (Rv) and the   resulting fragments (rs12979860-CC = 196 + 45 bp;   rs12979860-CT = 241 + 196 + 45 bp; rs12979860-TT   = 241 bp) were revealed by agarose gel electrophoresis   (3%) stained with GelRed (Biotium, CA, USA).      

 

 

Statistical analysis

 

 

The allelic frequencies were determined, and Hardy-   Weinberg equilibrium was assessed using the chisquare   test (Microsoft Excel GenAIEx 6.5, Peakall and   Smouse, 2012) to compare the genotype distribution.   Differences associated to European, Native American   or African component were determined using T test   (GraphPad Prism 9). In all statistical analysis a p<0.05   was considered as statistically significant and α=0.05   was set as the risk level.     

 

 

RESULTS AND DISCUSSION

 

 

The average individual ancestry was estimated as 69.4%   European, 26.3% Native American and 4.3% African.   Frequencies lower than 0.02 were not included in the   data analysis since they may be associated to technical   artifacts. The European component was present in every   tested sample, with individual frequencies ranging from   0.02 to 1. The Native American component was also   detected but to a lesser extent, in 79% of the samples   (frequencies 0.02-0.8). Finally, the African ancestry   was detected in 41% of the samples, with a frequency   range from 0.02 to 0.23 (Figure 1, modified from Avena   et al., 2012). This evidences the multiplicity of origins of   Buenos Aires´ population, resulting of the miscegenation   between Native Americans, enslaved Africans who came   mainly from West Africa and Mozambique until the   first half of the 19th century (Fejerman et al., 2005) and   European immigrants, mainly from Italy and Spain, who   arrived in the country between 1870 and 1960 (Avena et   al., 2006; Muzzio et al., 2018). These results are in line   with previously published data (Avena et al., 2006),   further challenging the European self-perception as   Argentina’s identity.  

 

Figure 1. Frequency distribution of the individual European (a), Native American (b) and African ancestry (c) among healthy donors from Buenos   Aires, Argentina, enrolled in this study (n=96). Modified from Avena et al. (2012).

 

Several studies have reported the distribution of   the rs12979860 genotypes in different populations,   mainly assessing its correlation with the susceptibility   to different viral infections and response to antiviral   treatments (Wu et al., 2012; Porto et al., 2015; Taheri et   al., 2015; Echeverría et al., 2018). The correlation of this   distribution and the local ancestry of these populations   as well as its implications have also been assessed   (Indolfi et al., 2014b; Rizzo et al., 2016), though this is   the first report in an Argentinean global population.   The overall distribution of rs12979860-CC, CT and TT   was 29.17%, 50.0% and 20.83%, respectively. Hardy-   Weinberg equation was used to calculate the genetic   variation of this population at equilibrium. Significant   differences were not detected (chi-square test: 0.00469;   p=0.99766), thus suggesting that the impact of posible   microevolutionary mechanisms and population   structure is not significant. The allelic frequencies for   C and T were 54.17% and 45.83%, respectively. These   results differ from data reported in HCV chronically   infected patients of a public center in Buenos Aires,   with an allelic frequency of C=0.6 and 45.0% of   heterozygosity (Machicote et al., 2018). This higher   frequency of rs12979860-C is expected as it is known   that this allele is favorable in both acute and chronic   HCV infection. In this regard, the differences observed   between healthy and infected individuals highlight the   impact of assessing global populations when studying   the distribution of this kind of markers.  

A significant increase in the frequency of CC   genotype was observed among donors with a strong   European contribution (Figure 2a, p<0.05). Our results   also suggest a greater impact of the Native American   component among donors carrying the T allele (both   CT and TT genotypes), although differences were   marginally significant (Figure 2b). No differences in the   rs12979860 distribution were directly attributable to the   African component (Figure 2c, p>0.05), represented at   low levels in our sample.   Based on previously reported data on the composition   and immigration patterns of the admixed population of   Buenos Aires (Avena et al., 2012), we defined our parental   population including sub-Saharan Africans (involved in   slavery trafficking) and Europeans from Italy and Spain   (Avena et al., 2006). To minimize bias, we only considered reported data on the rs12979860 distribution (Table S1)   from non-cosmopolitan populations with a sample size   greater than 50. Ethiopian Jews and Sephardic Jews from   Rome, Italy, were also excluded, as these groups tend   to be endogamous and have a different origin, which   may introduce certain bias to our analysis. The mean   frequency of the rs12979860-C allele for this parental   population is 0.654 for Europeans, 0.298 for Africans   and 0.518 for Native Americans (table S1). However, data   available regarding the Native American component   are scarce and are often based either on cosmopolitan   admixed populations or studies with very small sample   sizes and variable results. Despite the lack of a robust   sample to perform comparisons, our results suggest   that populations with greater autochthonous ancestry   tend to exhibit higher frequencies of the rs12979860-T   allele.   Further studies are needed to fully characterize   the distribution of this polymorphism in Latin   America, as available data seem to be contradictory. To   explain this it is important, regarding cosmopolitan   populations, to disclose their composition and their   genetic ancestry in order to determine their parental   populations´contribution. Latin American cosmopolitan   populations are known to be admixed, but the European,   Native American and sub-Saharan contributions have   marked regional differences. Hence the relevance of   studying cases such as the one here described considering   the genetic ancestry of the population under study.  

 

Figure 2. Distribution of European (a), Native American (b) and African ancestry (c) among individuals carrying rs12979860-CC, CT and TT genotypes.   p<0.05 were considered as statistically significant.

 

The frequency of rs12979860-C in Buenos Aires´   individuals was similar to previously reported data for   populations from Tuscany (C=0.603) in Italy, which are   among the lowest compared to other West European   populations (Table S1). The reported frequency of this   allele in an Iberian population, however, was higher   than the one described in our study (C=0.705, Table S1).   Although immigrants from both Italy and Spain are the   main determinants of the European ancestry of Buenos   Aires´ population (Avena et al., 2006), it is to note that   most of the immigrants in Buenos Aires (and Argentina)   were of Italian origin (Avena et al. 2006). This may   explain, at least partially, the frequencies here described.   In order to further characterize the European   contribution to the rs12979860 distribution we   considered, when available, the self-reported data   about grandparents’ origins. Interestingly, a total   of 53 individuals declared the nonexistence of   grandparents of European origin (8/53:CC, 33/53:CT and   12/53:TT), while only 36 individuals reported at least   one grandparent from Italy, Spain/Portugal or other   European countries (14/36:CC, 16/36:CT and 6/36:TT).   This may be attributed to the fact that the vast majority   of immigrants arrived in Buenos Aires before 1950. In   our sample, the presence of Iberian ancestry seems to   be underrepresented, as genealogical data suggest that   the self-reported Italian ancestry was 33.0% higher   than Iberian ancestry. Altogether, our results may be   explained by the higher presence of Italian ancestry   among European descendants in our sample, as well   as by the admixture of these individuals with Native   Americans and Africans or afro-descendants with   a higher rs12979860-T frequency, thus increasing   the heterozygosity and the rs12979860-T frequency.   However, it is important to consider that, despite being   very useful especially in regions with recent immigration   patterns (Avena et al. 2012), this kind of surveys must be   carefully analyzed, since different social and economic   aspects may influence the individual self-perceived   ancestry, as it was recently reported (Paschetta et al.   2021).  

Notably, most of the populations that have been   included in large-scale immunogenomic studies were of European origin, and might include certain bias by   demographic, social and economic conditions of nonrandomly   selected individuals (Peng et al., 2021). This   may have affected the representativeness of the sample,   thus compromising the conclusions of those studies.   Therefore, increasing the genetic diversity while   considering these structural inequalities is mandatory   in order to obtain more reliable results. The PCR-RFLP   protocol here applied was previously described and fully   validated against PCR-sequencing, with a concordance   of 100% in the results obtained for C/T alleles (Sharafi et   al., 2012). In this regard, the use of a simple low-cost and   high-yielding technique is paramount, since it allows   small regional laboratories with limited resources to   conduct population genetic studies, thus reducing the   sampling bias that may occur in large cosmopolitan   cities. This is particularly relevant in regions such as   South America, in which the availability of qPCR or   sequencing platforms is still limited.   During the last years, there has been a growing   interest on the impact of genetic ancestry on the immune   response against viral infections (Mersha and Abebe,   2015). The molecular determinants responsible for   those associations are being increasingly understood,   and interferon pathways and their expression patterns   seem to be influenced by genetic ancestry (Miretti and   Beck, 2006; Randolph et al., 2021), as suggested by our   results.  

In the context of the COVID-19 pandemic and   considering that IFNλ4 can elicit an antiviral response   against RNA viruses, including some coronaviruses,   several studies have assessed whether rs12979860 is   involved in SARS-CoV-2 susceptibility and COVID-19   outcome. In this regard, it was reported that the T allele   was overexpressed in COVID-19 patients compared   to the general healthy population (36.2% vs. 26.4%),   thus, this allele was proposed as a possible risk factor   for COVID-19 (Saponi-Cortes et al., 2021). This was also   supported by Rahimi et al. (2021), who demonstrated   a positive correlation between the survival rate in   COVID-19 patients and the rs12979860-CC genotype,   which is also favorable to control other infectious   diseases caused by RNA viruses. On the other hand, a   higher frequency of the CC genotype among COVID-19   patients was reported in a different study, suggesting   that people with the C allele (both CT or CC genotypes)   are more susceptible to SARS-CoV-2 infection (Agwa   et al., 2021). However, only slight differences between   infected and control groups are shown (44.7% vs.   44.0%, respectively) and allelic frequencies are the same   for both groups (C=34.0%, T=66.0%). In that study, it   was also reported that 52.6% of the TT genotypes were   classified as severe disease compared to 45.8% and   34.9% in the TC and CC genotypes, respectively (Agwa   et al., 2021), which seem to be in line with the results   published by Saponi-Cortes et al. (2021) and Rahimi et   al. (2021). It is be noted, also, that the differences shown   by Agwa et al. (2021) may not be exclusively explained   by rs12979860 variants, considering that comorbidities   were found in 57.4% of the infected group (and in 18.0%   of controls). This highlights the relevance of carrying out   a properly designed and unbiased sampling as well as a   cautious analysis of the results in order to discern this   type of controversies when assessing the differential   distribution of these variants in different populations.  

 

 

CONCLUSIONS

 

 

Given its importance and its apparent association   with different infectious diseases, there is a growing   interest in assessing IFNλ4 polymorphisms. As a whole,   this study describes for the first time the distribution   of rs12979860 polymorphism in a healthy sample of   the population of Buenos Aires, Argentina, further   demonstrating that these frequencies are associated to   the composition of the population. This, in addition to   being useful in anthropological studies, may contribute   to the study of different infectious diseases for which   interferon antiviral responses are key.  

 

ACKNOWLEDGMENTS  

We thank Dr. Karina Trono for critical reading of the manuscript. This research was funded by the services provided by AC´s group through STAN-CONICET. Other support came from PIP CONICET 2111.   

 

BIBLIOGRAPHY  

Agwa S.H.A., Kamel M.M., Elghazaly H., Abd Elsamee A.M., Hafez H.,  Girgis S.A., Elarab H.E., Ebeid F.S.E., Sayed S.M., Sherif L., Matboli M.   (2021) Association between Interferon-Lambda-3 rs12979860, TLL1   rs17047200 and DDR1 rs4618569 Variant Polymorphisms with the   Course and Outcome of SARS-CoV-2 Patients. Genes, 12(6). https://doi.org/10.3390/GENES12060830  

Angulo J., Pino K., Echeverría-Chagas N., Marco C., Martínez-Valdebenito C., Galeno H., Villagra E., Vera L., Lagos N., Becerra N., Mora J.,  Bermúdez A., Cárcamo M., Díaz J., Miquel J.F., Ferres M., López-Lastra M. (2015) Association of Single-Nucleotide Polymorphisms in IL28B,   but Not TNF-α, With Severity of Disease Caused by Andes Virus.   Clinical Infectious Diseases, 61(12): e62-e69. https://doi.org/10.1093/CID/CIV830  

Avena S.A., Goicoechea S.A., Rey J., Dugoujon J.M., Dejean C.B., Carnese F.R. (2006) Gene mixture in a population sample from Buenos Aires   City. Medicina, 66(2): 113-118.  

Avena S., Via M., Ziv E., Pérez-Stable E.J., Gignoux C.R., Dejean C.,  Huntsman S., Torres-Mejía G., Dutil J., Matta J.L., Beckman K.,  Burchard E.G., Parolin M.L., Goicoechea A., Acreche N., Boquet M., Ríos Part M.D.C., Fernández V., Rey J., Fejerman L. (2012) Heterogeneity in   genetic admixture across different regions of Argentina. PloS One,   7(4). https://doi.org/10.1371/JOURNAL.PONE.0034695  

Bamford C.G.G., Aranday-Cortes E., Filipe I.C., Sukumar S., Mair D., Filipe A. da S.,  Mendoza J.L., Garcia K.C., Fan S., Tishkoff S.A., McLauchlan J. (2018) A polymorphic   residue that attenuates the antiviral   potential of interferon lambda 4 in hominid   lineages. PLoS Pathogens, 14(10). https://doi.org/10.1371/journal.ppat.1007307  

Booth D., George J. (2013) Loss of function   of the new interferon IFN-λ4 may confer   protection from hepatitis C. Nat. Genet.  45(2): 119-120. https://doi.org/10.1038/NG.2537  

Bravo D., Solano C., Giménez E., Remigia M.J.,  Corrales I., Amat P., Navarro D. (2014) Effect   of the IL28B Rs12979860 C/T polymorphism   on the incidence and features of active   cytomegalovirus infection in allogeneic   stem cell transplant patients. J. Med. Virol.   86(5): 838-844. https://doi.org/10.1002/jmv.23865  

Chatterjee K. (2010) Host genetic factors   in susceptibility to HIV-1 infection and   progression to AIDS. J. Genet. 89(1): 109-116.   https://doi.org/10.1007/s12041-010-0003-4  

Chmelova K., Frankova S., Jirsa M., Neroldova M., Sticova E., Merta D., Senkerikova R.,  Trunecka P., Spicak J., Sperl J. (2019) IL28B   rs12979860 T allele protects against CMV   disease in liver transplant recipients in the   post-prophylaxis and late period. Transpl.   Infec. Dis. 21(4): e13124. https://doi.org/10.1111/tid.13124  

da Silva Cezar R.D., da Silva Castanha P.M.,  Matos Freire N., Mola C., Feliciano do Carmo R., Tenório Cordeiro M., Baptista P., Silva Vasconcelos L.R., Moura P., da Silva Teixeira V.G. (2020) Association between interferon   lambda 3 rs12979860 polymorphism and   clinical outcome in dengue virus-infected   children. Int. J. Immunogenet. 47(4): 351-358. https://doi.org/10.1111/iji.12477  

Echeverría N., Chiodi D., López P., Sanchez Ciceron A., Angulo J., López-Lastra M.,  Silvera P., Canavesi A., Bianchi C., Colistro V.,  Cristina J., Hernandez N., Moreno P. (2018)   IL28B gene polymorphism rs12979860, but   not rs8099917, contributes to the occurrence   of chronic HCV infection in Uruguayan   patients. Virol. J. 15(1): 1-10. https://doi.org/10.1186/s12985-018-0946-2  

Fan W., Xie S., Zhao X., Li N., Chang C., Li L.,  Yu G., Chi X., Pan Y., Niu J., Zhong J., Sun B.   (2016) IFN-λ4 desensitizes the response   to IFN-α treatment in chronic hepatitis C   through long-term induction of USP18. J.   Gen. Virol. 97(9): 2210-2220. https://doi.org/10.1099/JGV.0.000522  

Fang M.Z., Jackson S.S., O’Brien T.R. (2020)   IFNL4: Notable variants and associated   phenotypes. Gene, 730: 144289. https://doi.org/10.1016/J.GENE.2019.  

Fejerman L., Carnese F.R., Goicoechea A.S.,  Avena S.A., Dejean C.B., Ward R.H. (2005)   African ancestry of the population of Buenos   Aires. Am. J. Phys. Anthropol. 128(1): 164-170. https://doi.org/10.1002/AJPA.20083  

Ge D., Fellay J., Thompson A.J., Simon J.S.,  Shianna K.V., Urban T.J., Heinzen E.L., Qiu P., Bertelsen A.H., Muir A.J., Sulkowski M.,  McHutchison J.G., Goldstein D.B. (2009)   Genetic variation in IL28B predicts hepatitis   C treatment-induced viral clearance. Nature,   461(7262), 399-401. https://doi.org/10.1038/nature08309  

Hamming O.J., Terczyńska-Dyla E., Vieyres G.,  Dijkman R., Jørgensen S.E., Akhtar H., Siupka P., Pietschmann T., Thiel V., Hartmann R.   (2013) Interferon lambda 4 signals via the   IFNλ receptor to regulate antiviral activity   against HCV and coronaviruses. EMBO J.   32(23): 3055-3065. https://doi.org/10.1038/emboj.2013.232  

Indolfi G., Mangone G., Calvo P.L., Bartolini E., Regoli M., Serranti D., Calitri C., Tovo P.A., De Martino M., Azzari C., Resti M.   (2014a) Interleukin 28B rs12979860   single-nucleotide polymorphism predicts   spontaneous clearance of hepatitis C virus   in children. J. Pediatr. Gastroenterol. Nutr.   58(5): 666-668. https://doi.org/10.1097/MPG.0000000000000275 

Indolfi G., Mangone G., Bartolini E., Nebbia G., Calvo P.L., Moriondo M., Tovo P.A., De Martino M., Azzari C., Resti M. (2014b)   Comparative analysis of rs12979860 SNP   of the IFNL3 gene in children with hepatitis   C and ethnic matched controls using 1000   Genomes Project data. PloS One, 9(1):   e0085899. https://doi.org/10.1371/JOURNAL.PONE.0085899  

Ispirologlu M., Bahcecioglu I.H., Demirel U.,  Yalniz M. (2017) Impact of interleukin 28B   rs12979860 C/T polymorphism on severity   of disease and response to treatment in   hepatitis delta. J. Infect. Dev. Ctries. 11(1):   58-64. https://doi.org/10.3855/jidc.6872  

Key F.M., Peter B., Dennis M.Y., Huerta-Sánchez E., Tang W., Prokunina-Olsson L., Nielsen R.,  Andrés A.M. (2014) Selection on a Variant   Associated with Improved Viral Clearance   Drives Local, Adaptive Pseudogenization of   Interferon Lambda 4 (IFNL4). PLoS Genetics, 10(10): e1004681. https://doi.org/10.1371/journal.pgen.1004681  

Kotenko S.V., Gallagher G., Baurin V.V., Lewis-Antes A., Shen M., Shah N.K., Langer J.A.,  Sheikh F., Dickensheets H., Donnelly R.P.   (2003) IFN-λs mediate antiviral protection   through a distinct class II cytokine receptor   complex. Nat Immunol. 4(1): 69-77. https://doi.org/10.1038/ni875  

Lazear H.M., Nice T.J., Diamond M.S. (2015)   Interferon-λ: Immune Functions at   Barrier Surfaces and Beyond. Immunity,   43(1): 15-28. https://doi.org/10.1016/j.immuni.2015.07.001  

Machicote A., Flichmann D., Arana E., Paz S.,  Fainboim H., Fainboim L., Fernández P. M., Muñiz F.J., Aires B. (2018) IL28B SNPs   rs12979860 and rs8099917 Are Associated   with Inflammatory Response in Argentine   Chronic HCV Patients. Int. J. Clin. Med. 9: 79- 91. https://doi.org/10.4236/ijcm.2018.92009  

Mersha T.B., Abebe T. (2015) Self-reported race/   ethnicity in the age of genomic research:   its potential impact on understanding   health disparities. Hum. Genomics, 9(1):   1-15. https://doi.org/10.1186/S40246-014-0023-X  

Miretti M.M., Beck S. (2006). Immunogenomics:   molecular hide and seek. Hum. Genomics,   2(4): 244-251. https://doi.org/10.1186/1479-7364-2-4-244  

Muzzio M., Motti J.M.B., Paz Sepulveda P.B.,  Yee M., Cooke T., Santos M.R., Ramallo V.,  Alfaro E.L., Dipierri J.E., Bailliet G., Bravi C.M., Bustamante C.D., Kenny E.E. (2018)   Population structure in Argentina. PloS One,   13(5): e0196325. https://doi.org/10.1371/JOURNAL.PONE.0196325  

O’Brien T.R., Prokunina-Olsson L., Donnelly R.P. (2014) IFN-λ4: the paradoxical new   member of the interferon lambda family. J.   Interferon Cytokine Res. 34(11): 829-838.   https://doi.org/10.1089/JIR.2013.0136  

Paschetta C., de Azevedo S., Ramallo V., Cintas C., Perez O., Navarro P., Bandieri L., Quinto-Sanchez M., Adhikari K., Bortolini M.C., Poletti Ferrara G., Gallo C., Bedoya G., Rothhammer F., Acuסa Alonzo V., Ruiz-Linares A., Gonzalez-Jose R. (2021) The   impact of socioeconomic and phenotypic   traits on self-perception of ethnicity in Latin America. Sci Rep 11(1):12617. https://doi.org/10.1038/s41598-021-92061-x  

Peakall R., Smouse P.E. (2012) GenAlEx 6.5:   genetic analysis in Excel. Population genetic   software for teaching and research--an   update. Bioinformatics, 28(19): 2537-2539.   https://doi.org/10.1093/BIOINFORMATICS/BTS460  

Pedergnana V., Abdel-Hamid M., Guergnon J., Mohsen A., Le Fouler L., Theodorou I.,  Mohamed M.K., Fontanet A., Plancoulaine S., Abel L. (2012) Analysis of IL28B variants   in an Egyptian population defines the   20 Kilobases minimal region involved   in spontaneous clearance of hepatitis C   virus. PLoS ONE, 7(6): e38578. https://doi.org/10.1371/journal.pone.0038578  

Peng K., Safonova Y., Shugay M., Popejoy A.B., Rodriguez O.L., Breden F., Brodin P., Burkhardt A.M., Bustamante C., Cao-Lormeau V.M., Corcoran M.M., Duffy D.,  Fuentes-Guajardo M., Fujita R., Greiff V.,  Jönsson V.D., Liu X., Quintana-Murci L.,  Rossetti M., … Mangul S. (2021) Diversity   in immunogenomics: the value and the   challenge. Nature Methods, 18(6): 588-591.   https://doi.org/10.1038/S41592-021-01169-5  

Porto L.C., Fabrício-Silva G.M., Poschetzky B.,  Perez R., Carneiro dos Santos R., Cavalini L. (2015) Association of cytokine gene   polymorphisms with hepatitis C virus   infection in a population from Rio de Janeiro,   Brazil. Hepat. Med. 7: 71-79. https://doi.org/10.2147/HMER.S89447  

Prokunina-Olsson L. (2019) Genetics of   the Human Interferon Lambda Region. J.   Interferon Cytokine Res . 39(10): 599-608.   https://doi.org/10.1089/jir.2019.0043  

Prokunina-Olsson L., Muchmore B., Tang W., Pfeiffer R.M., Park H., Dickensheets H.,  Hergott D., Porter-Gill P., Mumy A., Kohaar I., Chen S., Brand N., Tarway M., Liu L.,  Sheikh F., Astemborski J., Bonkovsky H.L.,  Edlin B.R., Howell C.D., O’Brien T.R. (2013)   A variant upstream of IFNL3 (IL28B) creating   a new interferon gene IFNL4 is associated   with impaired clearance of hepatitis C virus.   Nature Genetics, 45(2): 164-171. https://doi.org/10.1038/ng.2521  

Rahimi P., Tarharoudi R., Rahimpour A.,  Mosayebi Amroabadi J., Ahmadi I., Anvari E.,  Siadat S.D., Aghasadeghi M., Fateh A. (2021)   The association between interferon lambda 3   and 4 gene single-nucleotide polymorphisms   and the recovery of COVID-19 patients. Virol.   J. 18(1): 1-7. https://doi.org/10.1186/S12985-021-01692-Z  

Ramamurthy N., Marchi E., Ansari M.A.,  Pedergnana V., Mclean A., Hudson E., Bowden R., Spencer C.C.A., Barnes E., Klenerman P. (2018) Impact of Interferon Lambda 4   Genotype on Interferon-Stimulated Gene   Expression During Direct-Acting Antiviral   Therapy for Hepatitis C. Hepatology, 68(3):   859-871. https://doi.org/10.1002/hep.29877 

Randolph H.E., Fiege J.K., Thielen B.K.,  Mickelson C.K., Shiratori M., Barroso-Batista J., Langlois R.A., Barreiro L.B. (2021) Genetic   ancestry effects on the response to viral   infection are pervasive but cell type specific.   Science, 374(6571): 1127-1133. https://doi.org/10.1126/SCIENCE.ABG0928  

Rizzo S.R.C.P., Gazito D., Pott-Junior H., Latini F.R.M., Castelo A. (2016) Prevalence of IFNL3   gene polymorphism among blood donors   and its relation to genomic profile of ancestry   in Brazil. Braz. J. Infect. Dis. 20(6): 619-622.   https://doi.org/10.1016/J.BJID.2016.10.002  

Saponi-Cortes J.M.R., Rivas M.D., Calle-Alonso F., Sanchez J.F., Costo A., Martin C.,  Zamorano J. (2021) IFNL4 genetic variant   can predispose to COVID-19. Sci. Rep. 11(1):   1-4. https://doi.org/10.1038/S41598-021-00747-Z  

Sharafi H., Pouryasin A., Alavian S.M., Behnava B., Keshvari M., Mehrnoush L., Salimi S.,  Kheradvar O. (2012) Development and   validation of a simple, Rapid and inexpensive   PCR-RFLP method for genotyping of   common IL28b polymorphisms: A useful   pharmacogenetic tool for prediction of   Hepatitis C treatment response. Hepat. Mon.   12(3): 190-195. https://doi.org/10.5812/hepatmon.849  

Sheppard P., Kindsvogel W., Xu W., Henderson K., Schlutsmeyer S., Whitmore T.E., Kuestner R., Garrigues U., Birks C., Roraback J.,  Ostrander C., Dong D., Shin J., Presnell S.,  Fox B., Haldeman B., Cooper E., Taft D.,  Gilbert T., Klucher K.M. (2003) IL-28, IL-   29 and their class II cytokine receptor IL-   28R. Nat. Immunol. 4(1): 63-68. https://doi.org/10.1038/ni873  

Taheri S., Aygen B., Korkmaz K., Yıldız O., Zararsız G., Canatan H. (2015)   Characterization of the Interleukin-28B   Gene rs12979860 C/T Polymorphism   in Turkish Chronic Hepatitis C Patients   and Healthy Individuals. Balk. Med. J.   32(2): 147-155. https://doi.org/10.5152/BALKANMEDJ.2015.15156  

Thomas D.L., Thio C.L., Martin M.P., Qi Y., Ge D., Ohuigin C., Kidd J., Kidd K., Khakoo S.I.,  Alexander G., Goedert J.J., Kirk G.D., Donfield S.M., Rosen H.R., Tobler L.H., Busch M.P.,  McHutchison J.G., Goldstein D.B., Carrington M. (2009) Genetic variation in IL28B and   spontaneous clearance of hepatitis C virus.   Nature, 461(7265): 798-801. https://doi.org/10.1038/nature08463  

Wu L.S., Wang H., Geng X.P. (2012) Two IL28B   polymorphisms are associated with the   treatment response of different genotypes   of hepatitis C in different racial populations:   A meta-analysis. Exp. Ther. Med. 3(2): 200-206. https://doi.org/10.3892/ETM.2011.385  

Zaidane I., Wakrim L., Oulad Lahsen A.,  Bensghir R., Chihab H., Jadid F.Z., El fihry R., Lamdini H., Fayssel N., Marhoum El Filali K., Oudghiri M., Benjelloun S., Ezzikouri S.   (2018) Interleukin 28B rs12979860 genotype   and Human Immunodeficiency Virus type   1: Susceptibility, AIDS development and  therapeutic outcome. Hum. Immunol.   79(1): 70-75. https://doi.org/10.1016/J.HUMIMM.2017.10.011   

Verificado por MonsterInsights