Vol. XXXIII Issue 1
Article 5
DOI: 10.35407/bag.2022.33.01.05
ARTÍCULOS ORIGINALES
Cytogenetic study in sand spiders (Sicariidae) from
the brazilian Caatinga: sex chromosome system diversity in closely related
species
Estudio
citogenético en arañas de arena (Sicariidae) de la Caatinga brasileña: diversidad
del sistema de cromosomas sexuales en especies estrechamente relacionadas
Gimenez-Pinheiro T.1
Carvalho L.S.2
Brescovit A.D.3
Magalhaes I.L.F.4
Schneider M.C.5 *
1 Universidade
Estadual do Piauí, UESPI, Campus Heróis do Jenipapo, Av. Santo Antônio, s/n, 64280-000,
Campo Maior, Piauí, Brasil.
2 Universidade
Federal do Piauí, UFPI, Campus Amílcar Ferreira Sobral, BR 343, km 3.5, 64800-000,
Floriano, Piauí, Brasil.
3 Laboratório de
Coleções Zoológicas, Instituto Butantan, Av. Vital Brasil, 1500, 05503-900, São
Paulo, São Paulo, Brasil.
4
División Aracnología, Museo Argentino de Ciencias
Naturales “Bernardino Rivadavia”, Av. Angel Gallardo 470, C1405DJR, Buenos Aires, Argentina.
5 Universidade
Federal de Mato Grosso, UFMT, Instituto de Biociências, Departamento de
Biologia e Zoologia, Av. Fernando Corrêa da Costa, 2367, Bairro Boa Esperança, 78060-900,
Cuiabá, Mato Grosso, Brazil.
* Corresponding author: Marielle Cristina Schneider marielle.mcs@gmail.com ORCID 0000-0002-2888-6355
ABSTRACT
In this study, we
investigated the chromosomes of three species of Sicarius spiders from
the Brazilian Caatinga, using classical and molecular cytogenetic techniques.
Based on the phylogenetic approach, we also discussed about the variation of
diploid number, types of sex chromosome system and changes in the localization
of ribosomal genes of Scytodoidea. Sicarius are Synspermiata spiders
that together with the genera Loxosceles and Hexophthalma constitute
the family Sicariidae. In this group, the available cytogenetic data showed a
low diploid number range (2n♂=18 to 2n♂=23) and the presence of
only multiple sex chromosome systems (X1X2Y and X1X20). Mitotic metaphase
cells exhibited 2n♂=16+X1X2Y for Sicarius cariri and S. ornatus, and 2n♂=18+XY
for S. tropicus. In these species, silver impregnation revealed
nucleolar organizer region (Ag-NOR) on the terminal region of pair 1. In S.
ornatus and S. tropicus, the results obtained with fluorescent in
situ hybridization (FISH) using 18S rDNA probe were similar to Ag-NOR,
however in S. cariri, the ribosomal sites were localized in the terminal
region of the X1 sex chromosome. In this work, we presented the first
description of a simple sex chromosome system for Sicariidae, helping to
understand how the XY sex chromosome system evolved from the X1X2Y system. Additionally, FISH data incongruous with
Ag-NOR indicate that the cytogenetic studies in Sicariidae allow investigating
the relation between the karyotype evolution and the distribution and the
activity of rDNA genes.
Key
words: Karyotype, Mitosis,
Nucleolar organizer
region, rDNA, Sicarius
RESUMEN
En este estudio, investigamos los cromosomas
de tres especies de arañas Sicarius de la Caatinga brasileña, utilizando
técnicas de citogenética clásica y molecular. Usando un enfoque filogenético,
también discutimos la variación del número diploide, los tipos de sistema
cromosómico sexual y los cambios en la localización de los genes ribosómicos en
Scytodoidea. Los Sicarius son arañas Synspermiata que, junto con los
géneros Loxosceles y Hexophthalma, constituyen a la familia
Sicariidae. En este grupo, los datos citogenéticos disponibles mostraron un
rango de número diploide bajo (2n♂=18 a 2n♂=23) y únicamente la
presencia de sistemas de cromosomas sexuales múltiples (X1X2Y
y X1X20).
Las células mitóticas en metafase mostraron 2n♂=16+X1X2Y
para Sicarius cariri y S. ornatus, y 2n♂=18+XY para S.
tropicus. En estas especies, la impregnación de plata reveló la región
organizadora nucleolar (Ag-NOR) en la región terminal del par 1. En S.
ornatus y S. tropicus, los resultados obtenidos con la hibridación
in situ fluorescente (FISH) utilizando la sonda de ADNr 18S fueron similares a
los de Ag-NOR, sin embargo, en S. cariri los sitios ribosomales se
localizaron en la región terminal del cromosoma sexual X1.
En este trabajo, presentamos la primera descripción de un sistema cromosómico
sexual simple para Sicariidae, ayudando a entender cómo el sistema cromosómico
sexual XY evolucionó a partir del sistema X1X2Y.
Además, los datos de FISH incongruentes con Ag-NOR indican que los estudios
citogenéticos en Sicariidae permiten investigar la relación entre la evolución
del cariotipo y la distribución y la actividad de los genes de ADNr.
Palabras clave: Cariotipo, Mitosis,
Región organizadora nucleolar, ADNr,
Sicarius
Received: 01/02/2022
Revised
version received: 02/11/2022
Accepted: 03/15/2022
General
Editor:
Elsa Camadro
INTRODUCTION
The
spider family Sicariidae is considered of medical importance in the world (Lotz, 2012), including sedentary species, which
can be ground-dwelling hunters or web-weavers (Dias et al., 2010). Sicariidae includes 171 species
distributed into three genera: Hexophthalma composed of eight species, Sicarius,
with 21 species, and Loxosceles, the most diversified genera with 142
representatives (World Spider Catalog, 2021). This latter genus is well known
due to the toxicity of its venom, causing skin necrosis, renal failure and
haemolysis (Silva et al., 2004; Vetter, 2008). Hexophthalma spiders occur only in southern
Africa while Loxosceles presents widest distribution, with species
described in America, Africa, Mediterranean Europe and Asia; however, the
largest diversity of species is recorded in the American continent (World
Spider Catalog, 2021). Sicarius is distributed in South and Central
America and is restricted to xeric habitats, mainly deserts and tropical dry
forests (Magalhaes et al., 2013).
For
many years, in Brazil only one Sicarius species was known, S.
tropicus (Mello-Leitão, 1936). However, recently Magalhaes et al.
(2013,
2017) described other species from this country, namely S. boliviensis Magalhaes,
Brescovit & Santos, 2017, S. cariri Magalhaes, Brescovit &
Santos, 2013, S. diadorim Magalhaes, Brescovit & Santos, 2013, S.
jequitinhonha Magalhaes, Brescovit & Santos, 2017, S. ornatus Magalhaes,
Brescovit & Santos, 2013, and S. saci Magalhaes, Brescovit &
Santos, 2017. The monophyly of Sicariidae is well supported by morphological (Platnick et al.,
1991; Binford et al.,
2008; Labarque y Ramírez,
2012;
Magalhaes et al., 2013, 2017) and molecular data (Wheeler et al.,
2017 contra
Binford et al., 2008). Some characteristics considered as
synapomorphies for sicariids are modifications in chelicerae setae, tarsal
claws, abdominal entapophysis, and the venom protein sphingomyelinase D, which
is responsible for the envenomation symptoms (Binford y Wells, 2003; Magalhaes et
al., 2017).
Sicariidae
belongs to the monophyletic superfamily Scytodoidea composed by (Sicariidae
(Drymusidae + Periogopidae) (Ochyroceratidae + Scytodidae))) (Labarque y Ramírez,
2012; Wheeler et al.,
2017).
In this group, Scytodidae is the most diverse, including a total of five genera
and 245 known species (World Spider Catalog, 2021), but only five of them
belonging to Scytodes were analyzed from the cytogenetic point of view (Araujo et al.,
2021).
The scytodids present a high variability in diploid number, from 2n♂=13
to 2n♂=31, but a simple and conserved sex chromosome system of the X0
type. The exception is Scytodes globula Nicolet, 1849 that revealed an
intraspecific variation due to the occurrence of X0 and X1X20
systems (Diaz y Saez, 1966; Rodríguez-Gil et al., 2002; Araujo et al.,
2008).
Ochyroceratidae
possess 168 species described into 10 genera, but only a North American
undetermined species of Ochyrocera was cytogenetically analysed,
exhibiting 2n♂=13 and X0 sex chromosome system (Král et al.,
2006).
The family Drymusidae includes 17 species with chromosomal data only for Izithunzi
capense (Simon, 1893), from South Africa, with 2n♂=37+X1X2Y
(Král et al., 2006). Periegopidae is known only by three species from
Queensland and New Zealand (World Spider Catalog, 2021), and there are no
cytogenetic data for this family.
The
family Sicariidae has karyotype information for 15 representatives, showing low
diversity in the diploid number (2n♂=18 to 2n♂=23) and the
occurrence of only multiple sex chromosome systems of the X1X2Y
and X1X20
types (Araujo et al., 2021). Hexophthalma only has the diploid number
2n=20 described for females of an undetermined species (Král et al.,
2019).
The genus Loxosceles presents 12 species chromosomally
characterized, in which the following diploid numbers were identified:
2n♂=18 in L. reclusa Gertsch & Mulaik, 1940; 2n♂=19 in L.
spinulosa Purcell, 1904; 2n♂=20 in L. rufipes (Lucas, 1834);
2n♂=20-21 in L. rufescens (Dufour, 1820); 2n♂=23 in L.
amazonica Gertsch, 1967, L. gaucho Gertsch, 1967, L. hirsuta Mello-Leitão,
1931, L. intermedia Mello-Leitão, 1934, L. laeta (Nicolet, 1849),
L. puortoi Martins, Knysak & Bertani, 2002, L. similis Moenkhaus,
1898 and L. variegata Simon, 1897. All these species showed X1X2Y
sex chromosomes system, except L. rufipes and L. reclusa that
exhibited X1X20
system (Beçak y Beçak, 1960; Diaz y Saez, 1966; Hetzler, 1979; Silva, 1988; Tugmon et al., 1990; Oliveira et al., 1996, 1997; Silva et al., 2002; Král et al.,
2006; Kumbiçak, 2014; Araujo et al., 2020).
In
the genus Sicarius, only two species were investigated, S. tropicus (2n♂=19,
X1X2Y)
from Brazil and an undetermined species (2n=21, X1X2Y) from Cusco, Peru (Franco y Andía, 2013; Araujo et al., 2021), more likely to be Sicarius boliviensis,
owing to the sampling locality (Magalhaes et al., 2017). Nevertheless, the cytogenetic data
of S. tropicus could be considered preliminary because the karyotype
information is restricted to a brief description of diploid number and sex
chromosome system (Franco y Andía, 2013).
A
cytogenetic analysis of three Sicarius species from the Brazilian fauna
was accomplished in the present study, using standard staining, silver
impregnation to reveal the active nucleolar organizer regions (NORs), and fluorescent
in situ hybridization (FISH) with 18S rDNA probe to map the number and
localization of the major ribosomal genes. Among the 21 Scytodoidea spiders
karyotyped, only 10 species were examined regarding to the NOR distribution (Král et al.,
2006; Araujo et al.,
2008,
2020). Additionally, based on the phylogenetic approach, we discussed about the
chromosome evolution of Scytodoidea, focusing in the variation of diploid
number, types of sex chromosome system and change in the localization of
ribosomal genes.
MATERIALS AND METHODS
A
sample of 35 specimens was analyzed in this work. The data concerning the
number of individuals and the collection localities in Brazil are shown in Table
1. The vouchers were deposited in the arachnid collection of the Instituto
Butantan, São Paulo, (IBSP; curator A.D. Brescovit); Coleções Taxonômicas of
the Universidade Federal de Minas Gerais, Belo Horizonte (UFMG; curator A.J. Santos),
and Coleção de História Natural of the Universidade Federal do Piauí, Floriano
(CHNUFPI; curator L.S. Carvalho), in Brazil.
Table 1. Sicarius species cytogenetically analyzed in this work,
including the number of specimens and collection localities in Brazil. PI=state
of Piauí; SE=state of Sergipe; PB=state of Paraíba.

The
cytological preparations were obtained following the procedures of Araujo et al.
(2005).
The chromosome slides were stained with 3% Giemsa solution (3% commercial
Giemsa solution and 3% phosphate buffer pH 6.8, in distilled water),
silver-impregnated (Howell y Black, 1980) to detect the NORs and submitted to
FISH with 18S rDNA probes to localize the major ribosomal gene. The
morphological classification of chromosomes followed the nomenclature proposed
by Levan et al. (1964).
The
18S rDNA probes were obtained by PCR using the DNA of Physocyclus globosus (Taczanowski,
1874) (Pholcidae) and the primers 18S-F 5’ CGAGCGCTTTTATTAGACCA and 18S-R 5’
GGTTCACCTACGGAAACCTT (Forman et al., 2013). Probes were labeled with 11-dUTP-digoxigenin by
PCR. The FISH technique was performed according Pinkel et al. (1986). The chromosomal DNA was denatured
in 70% formamide for 5 min at 70º C and the hybridization solution was
denatured in a termal cycler for 10 min at 95ºC. Probes were detected with
anti-digoxigenin antibody conjugated to rhodamine. Chromosome spreads were
counterstained with 4’-6-diamidino-2-phenylindole (DAPI) and the slides were
mounted with antifading solution. The images were captured using a Zeiss Imager
A2 microscope, coupled to a digital camera and the Axio Vision software.
The
ancestral condition of diploid number, sex chromosome system and number of rDNA
sites was reconstructed in Mesquite (Maddison y Maddison, 2011), using the maximum parsimony
approach and the phylogenetic proposal of Wheeler et al. (2017). The chromosome data were obtained
from the present study and spider cytogenetic database (Araujo et al.,
2021).
RESULTS
Chromosome characterization
Mitotic
metaphase cells of male and female specimens of S. cariri showed the
diploid number and sex chromosome system 2n=16+X1X2Y and 2n=16+X1X1X2X2, respectively (Fig. 1A-B). All the chromosomes presented metacentric
morphology, with exception of submetacentric pair 2. Regarding to the size, the
autososomal chromosomes could be classified into three categories: large (pairs
1 and 2), medium (pairs 3 and 4) and small (pairs 5 to 8). In spermatogonial
cells, the X1 and Y sex chromosome were easily
identified as unpaired elements, which corresponded to the largest and smallest
chromosomes of the karyotype. The X2 chromosome
showed an intermediary size between the 2nd and 3rd autosomal pairs (Fig. 1A).

Figure 1. Karyotypes of three Sicarius species. A-B.
Sicarius cariri with 2n♂=16+X1X2Y and 2n♀=16+X1X1X2X2, respectively. C.
Sicarius ornatus, 2n♂=16+X1X2Y. D. Sicarius tropicus, 2n♂=18+XY. In all species, the chromosomes were
predominantly metacentrics. Scale bar=5μm.
Sicarius
ornatus also presented 2n♂=19. In the karyotype, three unpaired
chromosomes were identified, which were similar to the sex chromosomes of S.
cariri. Thus, S. ornatus should also display a X1X2Y
sex chromosome system. However, in this species, all autosomal pairs revealed
metacentric morphology, the X1 and
X2 sex chromosomes were submetacentric
and the Y was a tiny acrocentric chromosome (Fig. 1C). The autosomal pair 1 exhibited large size,
compared to the medium-sized pairs 2 to 5 and the smallest elements of the
karyotype, pairs 6 to 8. The X1 chromosome
presented a similar size to the pair 1, the X2 chromosome
was larger than the pair 2 and the Y was the smallest chromosome of the
karyotype (Fig. 1C).
In S.
tropicus, the mitotic metaphase cells evidenced 2n♂=20, with two unpaired
chromosomes, one large and other small-sized. The karyotype comparison with S.
cariri and S. ornatus and the analysis of meiotic cells permitted us
interpreted these unpaired elements as X and Y sex chromosomes. In S.
tropicus, all chromosomes presented metacentric morphology. The pair 1 was
large-sized, the pairs 2, 3 and 4 medium-sized and the pairs 5 to 9
small-sized. The X and Y sex chromosomes corresponded to the largest and the
smallest elements of the karyotype, respectively (Fig. 1D).
The
analysis of meiotic cells of S. cariri and S. tropicus revealed,
in the pachytene, autosomal chromosomes completely paired and a single and very
small element, interpreted as Y chromosome (Fig. 2A-B). For both species, the X sex chromosomes were not
identified in this meiotic substage. Diplotene cells of S. tropicus presented
9 autosomal bivalents, with up to two interstitial or terminal chiasmata, and
one heteromorphic bivalent, formed by the end-to-end paired XY chromosomes (Fig. 2C). Nuclei in metaphase II of this
species showed the haploid sets n=9+X and n=9+Y (Fig. 2D).

Figure 2. Testicular cells of Sicarius cariri (A) and Sicarius
tropicus (B-D) stained with Giemsa. A-B. Pachytene nuclei, showing
the univalent and very small Y chromosome. C. Diplotene with nine
autosomal bivalents and one heteromorphic XY bivalent. Note the end-to-end
association between the sex chromosomes. D. Metaphase II cells, with
n=9+X (left) and n=9+Y (right). Scale bar=10μm.
Silver-impregnated
mitotic metaphase nuclei of the three Sicarius species revealed active
NORs on the long arm terminal region of pair 1 (Fig. 3A-F). In S. cariri, the 18S rDNA sites were
located in the long arm terminal region of the X1 sex
chromosome (Fig. 4A). In this species, the incongruence between the
results of Ag-NOR and FISH were observed among the cells of a same individual
as well as in cells of different specimens. In S. ornatus and S.
tropicus, the ribosomal cistrons occurred only in the long arm terminal
region of the 1st autosomal pair (Fig. 4B-E), confirming the results of silver impregnation.

Figure 3. Mitotic metaphase cells of Sicarius species
submitted to Giemsa-staining (A, C, E) and silver impregnation (B, D, F) to
reveal the nucleolar organizer regions (arrowhead). A-B. Sicarius
cariri. C-D. Sicarius ornatus. E-F. Sicarius
tropicus. The cells showed in C and D are with incomplete diploid set. Scale bar=5μm.

Figure 4. Spermatogonial cells of Sicarius species after
fluorescent in situ hybridization with 18S rDNA probe. A. Mitotic
metaphase of Sicarius cariri, indicating rDNA site (arrowhead) in the X1 chromosome. B-C. Pachytene and mitotic
metaphase of Sicarius ornatus. Note the bright signal (arrowhead) in the
terminal region of one bivalent (B) and in pair 1 (C). D-E. Pachytene
and mitotic metaphase of Sicarius tropicus exhibiting rDNA (arrowhead)
in the terminal region of one bivalent (D) and in the 1st autosomal pair (E).
Scale bar=5μm.
Chromosome evolution
The
maximum parsimony analyses revealed 2n=18-22 as the ancestral autosomal number
for Scytodoidea and Sicariidae (Fig. 5A). Overall, the karyotype evolution occurred through
independent decreased in autosomal number, with the exception of two species of
Scytodidae (Scytodes fusca - 30 autosomes and Scytodes sp. - 26
chromosomes, without description of the sex chromosome system) and Drymusidae (Izithunzi
capense, 34 autosomes).

Figure 5. Chromosome evolution in Scytodoidea spiders obtained
after Mesquite analysis. A. Autosomal number. B. Number of X sex
chromosome. C. Presence of sex chromosome system including a Y
chromosome. D. Number of chromosomes with NOR or rDNA sites.
The
presence of sex chromosome system including two X chromosome and one Y
chromosome (X1X2Y)
seems to be the ancestral state for Sicariidae and the clade composed by
Sicariidae (Drymusidae + Periogopidae) (Fig. 5B, C). On the other hand, for Ochyroceratidae +
Scytodidae, the X0 sex chromosome system is the shared character (Fig. 5B, C). The only exception is an
unidentified species of the genus Scytodes, in which the sex chromosome
system was not described. Within Sicariidae, the only change in the number of X
sex chromosome was reported in S. tropicus with a XY sex chromosome
system. The loss of Y chromosome was recorded only in L. reclusa and L.
rufipes.
Despite
the low number of species characterized, the presence of three or four rDNA
sites seems to be the ancestral condition for Scytodoidea (Fig. 5D). However, this state was
frequently changed during the evolution of this group. In L. amazonica and
L. puortoi, these changes involved the increase of the number of major
rDNA cistrons while in Sicarius species seems to be occurred a decrease
in the number of these sites. The analyses also showed that in Ochyroceratidae
+ Scytodidae and Sicarius species, the ancestral rDNA number is lower
than those observed in Scytodoidea.
DISCUSSION
The
diploid number 2n=19, the X1X2Y sex chromosome system and the chromosomal morphology
predominantly metacentric herein observed in S. cariri and S. ornatus
are similar to those previously described for S. tropicus and only
one species of the genus Loxosceles, L. spinulosa (Král et al.,
2006; Araujo et al.,
2020).
Additionally, the X1X2Y sex chromosome system verified in S. cariri and
S. ornatus is the most common in Sicariidae, occurring in 12 out of the
15 species cytogenetically characterized so far (Araujo et al., 2020).
The tendency of decreasing of the diploid number verified in some Scytodoidea
species is the main mechanism of chromosome evolution for spiders and has been
reported in many studies accomplished with related species (Stávale et al.,
2010;
Araujo et al., 2020; Ávila Herrera et al., 2021). In an elegant cytogenetic work with many Pholcidae
spiders, in which data of molecular and paleontological studies were discussed,
Ávila Herrera et al. (2021) suggested that the X1X2Y
sex chromosome system possesses an ancient origin in spiders and could have
arise before the emergence of Araneomorphae lineage.
The
karyotype found here for S. tropicus (2n=18+XY) differed from that
registered for other population of this same species (2n=16+X1X2Y) (Araujo et al.,
2021),
and the description of a simple sex chromosome system of the XY type is
original for Sicariidae. The high similarity regarding to the size of the Y
chromosome among the Sicarius species having the X1X2Y
and XY systems indicates that the evolution of the XY system occurred through
rearrangements involving only the X chromosome. The XY system probably had
origin from the X1X2Y system, in which the ancestral and metacentric X1 and X2 chromosomes
were pericentrically inverted, originating subtelo-acrocentric chromosomes,
such as those verified in Sicarius sp. (Franco y Andía, 2013). In a subsequent event, the X1 and X2 chromosomes
were fused, converting the X1X2Y into a XY system. This hypothesis regarding XY sex
chromosome evolution was proposed by Král et al. (2006) and Ávila Herrera et al. (2021), analyzing the behavior of the XY
sex chromosomes during the meiosis of Diguetia albolineata (O.
Pickard-Cambridge, 1895) (Diguetidae) and Wugigarra sp., (Pholcidae)
respectively. In these species as well as in S. tropicus analyzed here,
the X and Y chromosomes exhibited only one end-to-end association during
prophase I, without the presence of chiasma. The present study in Sicarius species
filled in an important gap in the hypothesis of Král et al. (2006) about
the evolution of sex chromosomes systems in basal clades of Araneomorphae,
taking into account that the hypothetic X1X2Y system with subtelo-acrocentric X1 and X2chromosomes
was exclusively observed in Sicarius sp. (Franco y Andía, 2013).
The
differences related to diploid number and sex chromosome system observed in S.
tropicus (present study; Araujo et al., 2021) may represent an interpopulational variation,
indicating that the karyotype 2n=18+XY is not well established in all
populations of this species or it had an independent origin in the populations
analyzed by us. Magalhaes et al. (2014), performing a phylogeographic study in S. cariri,
using sequence data of nuclear and mitochondrial genes, revealed highly
structured populations, which might be evolving independently. It is possible
that S. tropicus populations are also strongly structured geographically,
which could explain the differences in the karyotypes. Alternatively, the
specimens initially described by Araujo et al. (2021) as S. tropicus could
correspond to another species of the genus Sicarius, considering that
the cytogenetic study accomplished by Araujo preceded the taxonomical and
systematic revision of the genus Sicarius (Magalhaes et al.,
2013, 2017).
The
supposed stability of number and localization of NORs in spiders has knocked down
with the increase of cytogenetic studies. In an analysis of NORs in 30
Pholcidae spiders, Ávila Herrera et al. (2021) revealed a great diversity of number of this site,
which can occur in autosomes and/or X sex chromosome. The results obtained
herein using FISH with rDNA probe only in three Sicarius species
revealed the presence of ribosomal cistrons in autosomes (S. ornatus and
S. tropicus) and X1 sex
chromosome (S. cariri). It is interesting to emphasize that this
difference of localization of rDNA in autosome/sex chromosome occurs in species
with similar karyotype characteristics, indicating that the changes involving
the ribosomal genes can be independent of the differentiation of the sex
chromosome system. In S. cariri, the localization of active NORs and 18S
rDNA showed incongruous data, considering that the silver-impregnated regions
were visualized on the terminal sites of the 1st autosomal pair, such as in S.
ornatus and S. tropicus, but the FISH evidenced a bright signal in
the terminal region of the X1 sex
chromosome. Therefore, in S. cariri the silver impregnation might have
evidenced false Ag-NORs, taking into account that this technique reveals the
NORs indirectly. This occurs due to the affinity of the silver nitrate by
acidic proteins associated with the rRNAs or heterochromatic regions (Sanchez et al.,
1995; Lorite et al.,
1997; Dobigny et al.,
2002; Kasahara, 2009; Kavalco et al., 2009; Reis et al., 2012). On the other hand, the
impregnation of the terminal region of pair 1 of S. cariri, which is
certainly carrier of 18S rDNA genes in the two other closely related species, S.
ornatus and S. tropicus, might suggest the presence of cryptic NORs
in S. cariri, such as those reported by Cabrero y Camacho (2008) in some grasshopper species. The
silver impregnation on pair 1 of S. cariri can represent a vestigial
locus of rDNA gene for this species, which was translocated to the X1 sex chromosome; this vestigial rDNA is very small to
be detected by the FISH technique but it retains its transcriptional activity.
In
conclusion, the data shown herein expanded the knowledge of the karyotype
diversity already registered for sicariid spiders. Moreover, we identified an
intriguing variation when the results of Ag-NOR and FISH were compared.
Therefore, the Scytodoidea spiders are not only interesting for cytogenetic
studies due to the variability in the sex chromosome system, but also because
they are suitable for investigating karyotype evolution in spiders and its
relationship to the distribution and activity of rDNA genes.
ACKNOWLEDGEMENTS
This
research was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo,
FAPESP (2011/19873-9; 2011/21643-1; 2011/50689-0), Conselho Nacional de
Desenvolvimento Científico e Tecnológico (CNPq), as part of the Programa de
Pesquisas em Biodiversidade do Semiárido (558317/2009-0; 457471/2012-3), and CNPq
grant to ADB (PQ 303903/2019-8) and Fundação Butantan (001.0708.000636/20).
BIBLIOGRAPHY
Araujo
D., Brescovit A.D., Rheims C.A., Cella D.M. (2005) Chromosomal data of two
pholcids (Araneae, Haplogynae): a new diploid number and the first
cytogenetical record for the new world clade. J. Arachn. 33: 591-596.
Araujo
D., Rheims C.A., Brescovit A.D., Cella D.M. (2008) Extreme degree of chromosome
number variability in species of the spider genus Scytodes (Araneae,
Haplogynae, Scytodidae). J. Zool. Syst. Evol. Res. 46: 89-95.
Araujo
D., Schneider M.C., Zacaro A.A., Oliveira E.G., Martins R., Brescovit A.D., Knysak
I., Cella D.M. (2020) Venomous Loxosceles species (Araneae, Haplogynae,
Sicariidae) from Brazil: 2n♂ = 23 and X1X2Y sex chromosome system as shared characteristics. Zool.
Sci. 37: 128-139.
Araujo
D., Schneider M.C., Paula-Neto E., Cella D.M. (2021) The spider cytogenetic
database. Available in www.arthropodacytogenetics.bio.br/spiderdatabase.
Accessed in November 2021.
Ávila
Herrera I.M., Král J., Pastuchová M., Forman M., Musilová J., Korinková T., Stalavsky
F., Zrzavá M., Nguyen P., Just P., Haddad C.R., Hirman M., Koubová M., Sadilék D.,
Huber B.A. (2021) Evolutionary pattern of karyotypes and meiosis in pholcid
spiders (Araneae: Pholcidae): implications for reconstructing chromosome
evolution of araneomorph spiders. BMC Ecol. Evol. 21: 75.
Beçak
W., Beçak M.L. (1960) Constituição cromossômica de duas espécies de aranhas do
gênero Loxosceles. Rev. Brasil. Biol. 20: 425-427.
Binford
G.J., Wells M.A. (2003) The phylogenetic distribution of sphingomyelinase D
activity in venoms of Haplogyne spiders. Comp. Bioch. Physiol. Part B 135: 25-33.
Binford
G.J. et al. (2008) Phylogenetic relationships of Loxosceles and Sicarius
spiders are consistente with Western Gondwanan vicariance. Mol. Phylog.
Evol. 49: 538-553.
Cabrero
J., Camacho J.P.M. (2008) Location and expression of ribosomal RNA genes in
grasshoppers: Abundance of silent and cryptic loci. Chrom. Res. 16: 595-607.
Dias
S.C., Carvalho L.S., Bonaldo A.B., Brescovit A.D. (2010) Refining the
establishment of guilds in Neotropical spiders (Arachnida: Araneae). J. Nat.
Hist. 44: 219-239.
Diaz
M.O., Saez F.A. (1966) Karyotypes of South-American Araneida. Mem. Inst.
Butantan 33: 153-154.
Dobigny
G., Ozouf-Costaz C., Bonillo C., Volobouev V. (2002) “Ag-NORs” are not always
true NORs: new evidence in mammals. Cytogenet. Genome Res. 98: 75-77.
Forman
M., Nguyen P., Hula V., Král J. (2013) Sex Chromosome Pairing and Extensive NOR
Polymorphism in Wadicosa fidelis (Araneae: Lycosidae). Cytogenet. Genome Res. 141: 43-49.
Franco
J.F., Andía J.M. (2013) El cariótipo
de Sicarius sp. (Araneae: Haplogynae: Sicariidae), y sus relaciones
citotaxonómicas. Bioma 1: 4-9.
Hetzler
S. (1979) Some studies of spider chromosomes. Am. Arach. 20: 20.
Howell
W M., Black D.A. (1980) Controlled silver staining of nucleolus organizer
regions with protective colloidal developer: a 1-step method. Experientia 36: 1014-1015.
Kasahara
S. (2009) Introdução à pesquisa em citogenética de vertebrados. 1ª ed, Ribeirão
Preto: Sociedade Brasileira de Genética. 160p.
Kavalco
K.F., Pazza R., Almeida-Toledo L.F. (2009) Astyanax bockmanni Vari and
Castro, 2007: an ambiguous karyotype in the Astyanax genus. Genetica 136:
135-139.
Král
J., Musilová J., Stahlavsky F., Rezac M., Akan Z., Edwards R.L., Coyle F.A., Almerje
C.R. (2006) Evolution of the karyotype and sex chromosome systems in basal
clades of araneomorph spiders (Araneae: Araneomorphae). Chrom. Res. 14: 859-880.
Král
J., Forman M., Korinková T., Lerma A.C.R., Haddad C.R., Musilová J., Rezac M., Herrera
I.M.A., Thakur S., Dippenaar-Schoeman A.S., Marec F., Horová L., Bures P. (2019)
Insights into the karyotype and genome evolution of haplogyne spiders indicate
a polyploid origin of lineage with holokinetic chromosomes. Sci. Reports 9: 3001.
Kumbiçak
Z. (2014) Cytogenetic characterization of ten araneomorph spiders (Araneae):
karyotypes and meiotic features. Biol. (Bratislava) 69: 644-650.
Labarque
F., Ramírez M. (2012) The placement of the spider genus Periegops and
the phylogeny of Scytodoidea (Araneae: Araneomorphae). Zootaxa 3312: 1-44.
Levan
A., Fredga K., Sandberg A.A. (1964) Nomenclature for centromeric position on
chromosomes. Hereditas 52: 201-220.
Lorite
P., Aranega A.E., Luque F., Palomeque T. (1997) Analysis of the nucleolar
organizing regions in the ant Tapinoma nigerrimum (Hymenoptera,
Formicidae). Heredity 78: 578-582.
Lotz
L.N. (2012) Present status of Sicariidae (Arachnida: Araneae) in the
Afrotropical region. Zootaxa 3522: 1-41.
Maddison
W.P., Maddison D.R. (2011) Mesquite: A modular system for evolutionary
analysis. Version 2.75.
Magalhaes
I.L.F., Brescovit A.D., Santos A.J. (2013) The six-eyed sand spiders of the
genus Sicarius (Araneae: Haplogynae: Sicariidae) from the Brazilian
Caatinga. Zootaxa 3599: 101-135.
Magalhaes
I.L.F., Oliveira U., Santos F., Vidigal T.H.D.A., Brescovit A.D., Santos A.J. (2014)
Strong spatial structure, Pliocene diversification and cryptic diversity in the
Neotropical dry forest spider Sicarius cariri. Mol. Ecol.: 5323-5336.
Magalhaes
I.L.F., Brescovit A.D., Santos A.J. (2017) Phylogeny of Sicariidae spiders
(Araneae: Haplogynae), with a monograph on Neotropical Sicarius. Zool.
J. Linn. Soc. 179: 767-864.
Oliveira
E.G., Cella D.M., Brescovit A.D. (1996) The karyotype of Loxosceles gaucho and
Ctenusornatus (Arachnida, Araneae, Sicariidae, Ctenidae). Rev. Bras. Gen.
18: 128.
Oliveira
E.G., Cella D.M., Brescovit A.D. (1997) Karyotype of Loxosceles intermedia and
Loxosceles laeta (Arachnida, Araneae, Sicariidae) NeoX1 NeoX2Y
sex determination mechanism and NORs. Rev. Bras. Gen. 20: 77.
Pinkel
D., Straume T., Gray J.W. (1986) Cytogenetic analysis using quantitative,
high-sensitivity, fluorescence hybridization. Proc. Natl. Acad. Sci. USA 83: 2934-2938.
Platnick
N.I., Coddington J.A., Forster R.R., Griswold C.E. (1991) Spinneret morphology
and the phylogeny of Haplogyne spiders (Araneae, Araneomorphae). Am. Mus. Nat.
Hist. 3016: 1-73.
Reis
D.A.R., Brandão K.O., Almeida-Toledo L.F., Pazza R., Kavalco K.F. (2012) Localização
física dos genes ribossomais 5S e 18S em Ancistrus sp. (Loricariidae: Ancistrini) de Angra dos Reis/RJ, Bacia dos
Rios Costeiros. Evol. Cons. Biod. 3: 39-44.
Rodríguez-Gil
S.G., Mola L.M., Papeschi A.G., Scioscia C.L. (2002) Cytogenetic heterogeneity
in common Haplogyne spiders from Argentina (Arachnida, Araneae). J. Arach. 30: 47-56.
Sanchez
A., Jimenez R., Burgos M., Stitou S., Zurita F., La Guardia R.D. (1995) Cytogenetic
peculiarities in the Algerian hedgehog: silver stains not only NORs but also
heterochromatic blocks. Heredity 75: 10-16.
Silva
D. (1988) Estudiocariotípico de Loxosceles laeta (Araneae: Loxoscelidae).
Rev. Per. Entomol. 31: 9-12.
Silva
R.W., Klisiowicz D.R., Cella D.M., Mangili O.C., Sbalqueiro I.J. (2002) Differential
distribution of constitutive heterochromatin in two species of brown spider: Loxosceles
intermedia and L. laeta (Aranae, Sicariidae), from the metropolitan
region of Curitba, PR (Brazil). Acta Biol. Paran. 31: 123-136.
Silva
P.H., Silveira R.B., Appel M.H., Mangili O.C., Gremski W., Veiga S.S. (2004) Brown
spiders and loxoscelism. Toxicon 44: 693-709.
Stávale
L.M., Schneider M.C., Brescovit A.D., Cella D.M. (2010) Chromosomal
characteristics and karyotype evolution of Oxyopidae spiders (Araneae,
Entelegynae). Gen. Mol. Res. 10: 752-73.
Tugmon
C.R., Brown J.D., Horner N.V. (1990) Karyotypes of seventeen USA spiders
species (Araneae, Araneidae, Gnaphosidae, Loxoscelidae, Lycosidae, Oxyopidae,
Philodromidae, Salticidae and Theridiidae). J. Arach. 18: 41-48.
Vetter
R.S. (2008) Spiders of the genus Loxosceles (Araneae, Sicariidae): a
review of biological, medical and psychological aspects regarding envenomations. J. Arach. 36: 150-163.
Wheeler
W.C., Coddington J.A., Crowley L.M., Dimitrov D., Goloboff P.A., Griswold C.E.,
Hormiga G., Prendini L., Ramírez M.J., Sierwald P., et al. (2017) The spider
tree of life: phylogeny of Araneae based on target‐gene analyses from an extensive taxon
sampling. Cladistics: 1-43.
World
Spider Catalog (2021) World Spider Catalog. version 22.5. Natural History
Museum Bern, online at http://wsc.nmbe.ch. doi: 10.24436/2. Accessed in November
2021.

